Skip to content

kisSnp

The tool

kisSnp compares two sets of NGS raw reads, detecting Single Nucleotide Polymorphism occurring between the two sets.

The two sets typically come from the sequencing of two individuals from the same species or from closely related species.

Citation

If you use this software please cite:

P.Peterlongo, N.Schnel, N.Pisanti, M.-F. Sagot, V.Lacroix: Identifying SNPs without a reference genome by comparing raw reads,
proceedings of String Processing and Information Retrieval (SPIRE) 2010, Springer LNCS. In press.

Download (linux only)

Download the kisSnp suite here: kisSnp_suite1.0

Please read and accept the CeCILL License before use and diffusion.
Any feedback and comment is warmly encouraged.

Install

Just type ./install.sh in the kisSnp_suite1.0 directory. You may also make the installation by your own in the kisSnp1.0 and kisSnpCheckReads1.0 directories.

Usage

  • The ./kisSnp1.0/kisSnp_two_sets program compares two reads set and output putative SNPs. Use ./kisSnp1.0/kisSnp_two_sets -h for help.
  • The ./kisSnpCheckReads1.0/bin/kissnpcheckreads program checks and merges the kisSnp output, for keeping only read coherent SNPs. Use ./kisSnpCheckReads1.0/bin/kissnpcheckreads -h for help.

In case you’re not interested by tuning options, you may also pipeline the two previous tools using the command: compare_two_sets.sh:

compare_two_sets.sh reads1.fna reads2.fna coherent_result.fna uncoherent_results.fna: will compare reads1.fna and reads2.fna and store thre read coherent results in coherent_results.fna while keeping results produced by kisSnp but not read coherent in uncoherent_results.fna

Example

In the kisSnp_suite1.0 directory, type: ./compare_two_sets.sh reads_example/reads1.fna reads_example/reads2.fna results_comparison_reads1_reads2_coherent.fna results_comparison_reads1_reads2_uncoherent.fna

This will provide two files:

  1. results_comparison_reads1_reads2_coherent.fna provides read coherent SNP events. It contains set of four lines like these ones:

    2. >event_21_upper_path| A:8<11.14<15  B:0<3.49<5 | A –> T – SNP nb 22
    TGGGGGGAGGGGGGAGGGATAGCAATAGGAGATATACCTAATGCTAAAT
    >event_21_lower_path| A:12<14.14<17  B:17<19.20<22 | T –> A – SNP nb 22
    TGGGGGGAGGGGGGAGGGATAGCATTAGGAGATATACCTAATGCTAAAT

    Explanation:

    first line: give the upper path found by kisSnp, its coverage in readsA.fna (here min=8, average=11.14 and max=15) and readsB.fna (here min=0, average=3.49 and max=5), followed after the “|” by the comment in the file generated by kisSnp

    second line: the sequence containing the SNP in its central position

    third line: give the lower path found by kisSnp, its coverage in readsA.fna (here min=12, average=14.14 and max=17) and readsB.fna (here min=17, average=19.20 and max=22), followed after the “|” by the comment in the file generated by kisSnp

    last line: the sequence containing the SNP in its central position

    The coverage is the average coverage of each position. The coverage of one position is the number of reads that map this position.

  2. results_comparison_reads1_reads2_uncoherent.fna provides non read coherent SNP events. It also ouputs fasta file as previously presented.